Skip to main content

pKB817 (pBra-Hfq)
(Plasmid #174661)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174661 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBR322
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 5402
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB5alpha F'LacIQ
  • Growth instructions
    We recommend using a lacIQ strain, such as NEB5alpha F'LacIQ, in order to ensure that the expression of potentially toxic fusion proteins is kept repressed.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Hfq
  • Species
    E. coli
  • Insert Size (bp)
    303
  • Promoter lpp/lacUV5 (tandem promoter)
  • Tag / Fusion Protein
    • alpha NTD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GAACAGCGTACCGACCTGG
  • 3′ sequencing primer GGTGATGTCGGCGATATAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKB817 (pBra-Hfq) was a gift from Katherine Berry & Ann Hochschild (Addgene plasmid # 174661 ; http://n2t.net/addgene:174661 ; RRID:Addgene_174661)
  • For your References section:

    A bacterial three-hybrid assay detects Escherichia coli Hfq-sRNA interactions in vivo. Berry KE, Hochschild A. Nucleic Acids Res. 2018 Jan 25;46(2):e12. doi: 10.1093/nar/gkx1086. 10.1093/nar/gkx1086 PubMed 29140461