pKB817 (pBra-Hfq)
(Plasmid
#174661)
-
PurposePlpp/PlacUV5- directed synthesis of the alpha NTD fused to E. coli Hfq. Useful as three-hybrid positive control.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174661 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBR322
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 5402
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB5alpha F'LacIQ
-
Growth instructionsWe recommend using a lacIQ strain, such as NEB5alpha F'LacIQ, in order to ensure that the expression of potentially toxic fusion proteins is kept repressed.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHfq
-
SpeciesE. coli
-
Insert Size (bp)303
- Promoter lpp/lacUV5 (tandem promoter)
-
Tag
/ Fusion Protein
- alpha NTD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GAACAGCGTACCGACCTGG
- 3′ sequencing primer GGTGATGTCGGCGATATAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKB817 (pBra-Hfq) was a gift from Katherine Berry & Ann Hochschild (Addgene plasmid # 174661 ; http://n2t.net/addgene:174661 ; RRID:Addgene_174661) -
For your References section:
A bacterial three-hybrid assay detects Escherichia coli Hfq-sRNA interactions in vivo. Berry KE, Hochschild A. Nucleic Acids Res. 2018 Jan 25;46(2):e12. doi: 10.1093/nar/gkx1086. 10.1093/nar/gkx1086 PubMed 29140461