-
PurposeExpresses humanized firefly luciferase and mCherry and Hygromycin resistance linked by T2A, each controlled by a strong promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174665 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLV
-
Backbone manufacturerVectorBuilder
-
Vector typeMammalian Expression, Lentiviral, Luciferase
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameLUC2
-
Alt nameHuman codon optimized to reduce cryptic transcription factor binding sites
-
SpeciesSynthetic; Photinus pyralis
-
Insert Size (bp)1653
- Promoter Human eukaryotic translation elongation factor 1 α1 promoter
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry:T2A:Hygro
-
SpeciesDiscosoma sp.
-
Insert Size (bp)1797
- Promoter Human cytomegalovirus immediate early enhancer/promoter
-
Tag
/ Fusion Protein
- mCherry and hygromycin dual reporter gene linked by T2A
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer CCATTTCAGGTGTCGTGA
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV[Expression]-mCherry:T2A:Hygro-EF1A>Luc2 was a gift from Eli Bar (Addgene plasmid # 174665 ; http://n2t.net/addgene:174665 ; RRID:Addgene_174665)