pLenti X2 Neo/pTER shEGFP#2 (w22-2)
(Plasmid
#17480)
-
Purpose3rd gen lentiviral eGFP shRNA #2 (H1/TO promoter), 3’LTR insertion, Neo
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 17480 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonep156RRL-sinPPT-CMV-GFP-PRE/Nhe I
- Backbone size w/o insert (bp) 7919
-
Vector typeLentiviral, RNAi
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsStbl3, 37OC
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEnhanced green fluorescent protein shRNA #2
-
Alt nameshGFP #2
-
gRNA/shRNA sequenceCCGCTGGAGTACAACTACAACTTCAAGAGAGTTGTAGTTGTACTCCAGCTTTTT
-
Insert Size (bp)66
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (destroyed during cloning)
- 3′ cloning site Hind III (not destroyed)
- 5′ sequencing primer n/a (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the full plasmid sequence may be assembled and not fully confirmed. Minor mismatches should not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti X2 Neo/pTER shEGFP#2 (w22-2) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17480 ; http://n2t.net/addgene:17480 ; RRID:Addgene_17480) -
For your References section:
A versatile viral system for expression and depletion of proteins in mammalian cells. Campeau E, Ruhl VE, Rodier F, Smith CL, Rahmberg BL, Fuss JO, Campisi J, Yaswen P, Cooper PK, Kaufman PD.. PLoS One. 2009 Aug 6;4(8):e6529. 10.1371/journal.pone.0006529 PubMed 19657394