pSCARS1
(Plasmid
#174868)
-
PurposeContains TEF1p-TEF1in-hGFP-CYCt cassette and wildtype ARS1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174868 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS414
- Backbone size w/o insert (bp) 8835
- Total vector size (bp) 9843
-
Vector typeBacterial Expression, Yeast Expression, Synthetic Biology
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameARS1
-
Alt nameAutonomous replicating sequence
-
SpeciesYarrowia lipolytica
-
Insert Size (bp)986
-
GenBank IDX68252.1
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer tgagcgcgcgtaatacg
- 3′ sequencing primer gatggcatccctaaatttgatgaaag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCARS1 was a gift from Zengyi Shao (Addgene plasmid # 174868 ; http://n2t.net/addgene:174868 ; RRID:Addgene_174868) -
For your References section:
Revisiting the unique structure of autonomously replicating sequences in Yarrowia lipolytica and its role in pathway engineering. Lopez C, Cao M, Yao Z, Shao Z. Appl Microbiol Biotechnol. 2021 Aug 6. pii: 10.1007/s00253-021-11399-4. doi: 10.1007/s00253-021-11399-4. 10.1007/s00253-021-11399-4 PubMed 34357429