eSpCas9-EF-5Pou5f1
(Plasmid
#174872)
-
PurposeCRISPR vector for generating Pou5f1 STREAMING-tag KI cell
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174872 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneeSpCas9(1.1)
-
Backbone manufacturerFeng Zhang
- Total vector size (bp) 8519
-
Modifications to backboneWe applied an optimized sgRNA design (sgRNA(F+E)) (Chen et al., Cell, 2013).
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA for mouse Pou5f1
-
Alt namePou5f1 (Mus musculus)
-
gRNA/shRNA sequenceCCAACTTCACGGCATTGGGG
-
SpeciesSynthetic
-
GenBank ID
-
Entrez GenePou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer LKO1_5_primer
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eSpCas9-EF-5Pou5f1 was a gift from Hiroshi Ochiai (Addgene plasmid # 174872 ; http://n2t.net/addgene:174872 ; RRID:Addgene_174872) -
For your References section:
STREAMING-tag system reveals spatiotemporal relationships between transcriptional regulatory factors and transcriptional activity. Ohishi H, Shimada S, Uchino S, Li J, Sato Y, Shintani M, Owada H, Ohkawa Y, Pertsinidis A, Yamamoto T, Kimura H, Ochiai H. Nat Commun. 2022 Dec 20;13(1):7672. doi: 10.1038/s41467-022-35286-2. 10.1038/s41467-022-35286-2 PubMed 36539402