UIMLx2
(Plasmid
#174888)
-
PurposeUIMLx2 ubiquitin probe for K48 ubiquitylated proteins
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174888 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepet28(a)
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsBL21(DE3) with the pBirAcm plasmid encoding BirA should be used for expression
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMet4 UIML
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)252
-
Tag
/ Fusion Protein
- Avi-6xHis-Smt3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site salI (not destroyed)
- 3′ cloning site xhoI (not destroyed)
- 5′ sequencing primer tcc gaa ttc gag ctc cgt cga caa ggc aac act aaccta
- 3′ sequencing primer gctcgagagccgccccaatccacatt
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
UIMLx2 was a gift from Peter Kaiser (Addgene plasmid # 174888 ; http://n2t.net/addgene:174888 ; RRID:Addgene_174888) -
For your References section:
The Ubiquitin Interacting Motif-Like Domain of Met4 Selectively Binds K48 Polyubiquitin Chains. Villamil M, Xiao W, Yu C, Huang L, Xu P, Kaiser P. Mol Cell Proteomics. 2022 Jan;21(1):100175. doi: 10.1016/j.mcpro.2021.100175. Epub 2021 Nov 9. 10.1016/j.mcpro.2021.100175 PubMed 34763062