Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

MS2_SC2_S_WT
(Plasmid #175044)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 175044 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pMX
  • Backbone manufacturer
    Life Technologies
  • Backbone size w/o insert (bp) 2200
  • Total vector size (bp) 6264
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Maturation Protein
  • Alt name
    A-Protein
  • Species
    MS2 Phage
  • Insert Size (bp)
    1182
  • Promoter T7

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GATGTGCTGCAAGGCGATTAAGTTG
  • 3′ sequencing primer ctatggaaaaacgccagcaacg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Coat Protein Dimer
  • Species
    Synthetic
  • Insert Size (bp)
    801
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GATGTGCTGCAAGGCGATTAAGTTG
  • 3′ sequencing primer ctatggaaaaacgccagcaacg
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    S gene
  • Species
    SARS-CoV-2
  • Insert Size (bp)
    1654
  • Mutation
    WT (Amino Acid 319-869)
  • GenBank ID
    YP_009724390.1
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter T7

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (BsmBI) (destroyed during cloning)
  • 3′ cloning site Esp3I (BsmBI) (destroyed during cloning)
  • 5′ sequencing primer tgTCGAACAGAAAGTAATCGTATTGTAC
  • 3′ sequencing primer ctatggaaaaacgccagcaacg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MS2_SC2_S_WT was a gift from Paul Freemont (Addgene plasmid # 175044 ; http://n2t.net/addgene:175044 ; RRID:Addgene_175044)