-
Purpose(Empty Backbone) High Copy Number DNA Donor Vector for Bxb1 Integrase-mediated Cassette Exchange (for inserts <15kb) into dual site mouse strains (Bxb-GT/GA)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175390 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC18
-
Backbone manufacturerGenscript
- Backbone size (bp) 2686
-
Modifications to backbonereplaced 69bp: bases 396-464 (MCS) in pUC18 with 199bp: Bxb1 attB(GT)/MCS/Bxb1 attB(GA) - (sequence 1457-1654 in p5154)
-
Vector typeMouse Targeting ; Cloning vector, to be used to deliver transgene into mice with dual heterologous Bxb1 attP sites
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDepending on the nature of the sequence cloned into this plasmid, it may be beneficial to grow using NEB Stable, at 30C. However, just to maintain p5154 alone, DH5alpha is adequate (though we generally use DH10Beta).
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer GCCACCTGACGTCTAAGAAA
- 3′ sequencing primer GGGAAACGCCTGGTATCTTTA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We recommend this plasmid for the generation of the DNA donor when the inserted transgene size is <15kb. For larger insertions, we recommend the low-copy plasmid p5155 (175391).
Depending on the nature of the sequence cloned into this plasmid, it may be beneficial to grow using NEB Stable, at 30C. However, just to maintain p5154 alone, DH5alpha is adequate (though we generally use DH10Beta).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p5154 was a gift from Michael Wiles (Addgene plasmid # 175390 ; http://n2t.net/addgene:175390 ; RRID:Addgene_175390) -
For your References section:
Efficient targeted transgenesis of large donor DNA into multiple mouse genetic backgrounds using bacteriophage Bxb1 integrase. Low BE, Hosur V, Lesbirel S, Wiles MV. Sci Rep. 2022 Mar 31;12(1):5424. doi: 10.1038/s41598-022-09445-w. 10.1038/s41598-022-09445-w PubMed 35361849