p5155
(Plasmid
#175391)
-
Purpose(Empty Backbone) Low Copy Number DNA Donor Vector for Bxb1 Integrase-mediated Cassette Exchange (for inserts >15kb) into dual site mouse strains (Bxb-GT/GA)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175391 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBR322
-
Backbone manufacturerGenscript
- Backbone size (bp) 4361
-
Modifications to backbonereplaced AMP-R gene (857bp, 3293-4149) with NEO/KAN-R gene (797bp, p5155: 760-1556). replaced 1366bp (4272-1276) with 174bp: Bxb1 attB(GT)/MCS/Bxb1 attB(GA) - (sequence 1769-1852 in p5155).
-
Vector typeMouse Targeting ; Cloning vector, to be used to deliver transgene into mice with dual heterologous Bxb1 attP sites
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Cloning Information
- 5′ sequencing primer GATTGTCTGTTGTGCCCAGTCA
- 3′ sequencing primer CGCGTATCGGTGATTCATTCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We recommend this low-copy plasmid for the generation of donor DNA when the inserted transgene size is >15kb. For smaller transgene insertions, we recommend the high-copy plasmid p5154 (Addgene 175390).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p5155 was a gift from Michael Wiles (Addgene plasmid # 175391 ; http://n2t.net/addgene:175391 ; RRID:Addgene_175391) -
For your References section:
Efficient targeted transgenesis of large donor DNA into multiple mouse genetic backgrounds using bacteriophage Bxb1 integrase. Low BE, Hosur V, Lesbirel S, Wiles MV. Sci Rep. 2022 Mar 31;12(1):5424. doi: 10.1038/s41598-022-09445-w. 10.1038/s41598-022-09445-w PubMed 35361849