Skip to main content

pCAG-lox-rox-STOP-rox-tRFP-pA-lox-ZsGreen-pA
(Plasmid #175438)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175438 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG-loxSTOPlox-ZsGreen
  • Backbone size w/o insert (bp) 5737
  • Total vector size (bp) 7602
  • Vector type
    Mammalian Expression, Cre/Lox ; Dre/Rox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    rox-STOP-rox-tRFP-pA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1865
  • Promoter pCAG
  • Tag / Fusion Protein
    • ZsGreen on backbone (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer pCAG forward (GCAACGTGCTGGTTATTGTG)
  • 3′ sequencing primer ZsGreen reverse (5’- CTCCATGCGGTACTTCATGG -3’)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Additional Primers:
tRFP forward (5'-ACTTCGTGGACCACAGAC-3’) and tRFP reverse
(5'-CACTTGAAGTGGTGGTTG-3’)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-lox-rox-STOP-rox-tRFP-pA-lox-ZsGreen-pA was a gift from Frank Bradke & Sebastián Dupraz (Addgene plasmid # 175438 ; http://n2t.net/addgene:175438 ; RRID:Addgene_175438)
  • For your References section:

    In Situ Visualization of Axon Growth and Growth Cone Dynamics in Acute Ex Vivo Embryonic Brain Slice Cultures. Alfadil E, Bradke F, Dupraz S. J Vis Exp. 2021 Oct 14;(176). doi: 10.3791/63068. 10.3791/63068 PubMed 34723948