Skip to main content

YSCD44A-c002
(Plasmid #175493)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175493 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pNIC-CTH0
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Single chain Fv CD44 antibody (H90)
  • Species
    M. musculus (mouse)
  • Tags / Fusion Proteins
    • pelB (N terminal on insert)
    • 3XFLAG-EK-His8 (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Ligation-independent cloning 5' site TTAAGAAGGAGATATACTATG ; 3' site GATTGGAAGTAGAGGTTCTCTGC. Gileadi lab uses DH10-Bac or SF9 cells for expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    YSCD44A-c002 was a gift from Opher Gileadi (Addgene plasmid # 175493 ; http://n2t.net/addgene:175493 ; RRID:Addgene_175493)