YSCD44A-c002
(Plasmid
#175493)
-
PurposeProtein expression in bacterial cells. Single chain Fv antibody to human CD44 Link domain. Can be used for crystallography.
-
Depositing Lab
-
Publication
-
Sequence Information
-
Sequences (2) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175493 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepNIC-CTH0
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSingle chain Fv CD44 antibody (H90)
-
SpeciesM. musculus (mouse)
-
Tags
/ Fusion Proteins
- pelB (N terminal on insert)
- 3XFLAG-EK-His8 (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Ligation-independent cloning 5' site TTAAGAAGGAGATATACTATG ; 3' site GATTGGAAGTAGAGGTTCTCTGC. Gileadi lab uses DH10-Bac or SF9 cells for expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YSCD44A-c002 was a gift from Opher Gileadi (Addgene plasmid # 175493 ; http://n2t.net/addgene:175493 ; RRID:Addgene_175493)