pTS26_QUAS_CsChrimson
(Plasmid
#175548)
-
PurposeExpresses the optogenetic channel CsChrimson off of a QUAS promoter and contains Piggybac terminal repeats for transposon-mediated integration
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175548 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepXL-BacII
-
Backbone manufacturerOlena Riabinina, Darya Task, Elizabeth Marr, Chun-Chieh Lin, Robert Alford, David A. O'Brochta & Christopher J. Potter
- Backbone size w/o insert (bp) 6637
- Total vector size (bp) 9233
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCsChrimson
-
SpeciesChloromonas subdivisa
-
Insert Size (bp)3289
-
GenBank IDKF992078
- Promoter QUAS
-
Tag
/ Fusion Protein
- tdTomato (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTCGAGCAAAATGAGCAGACTGGTCGCCGCTTC
- 3′ sequencing primer ATCCTCTAGAttacacctcgttctcgtagcagaaTTTATACAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe CsChrimson plasmid p20X was shared by Vivek Jayaraman
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTS26_QUAS_CsChrimson was a gift from Leslie Vosshall (Addgene plasmid # 175548 ; http://n2t.net/addgene:175548 ; RRID:Addgene_175548) -
For your References section:
A persistent behavioral state enables sustained predation of humans by mosquitoes. Sorrells TR, Pandey A, Rosas-Villegas A, Vosshall LB. Elife. 2022 May 12;11:e76663. doi: 10.7554/eLife.76663. 10.7554/eLife.76663 PubMed 35550041