pX330-NQL007-NANOG-sgRNA
(Plasmid
#175555)
-
PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse NANOG locus.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175555 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330
-
Backbone manufacturerAddgene 42230
-
Vector typeMammalian Expression, Mouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namespCas9-nuclease and sgRNA against mouse NANOG STOP Codon
-
gRNA/shRNA sequenceTATGAGACTTACGCAACATC
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-NQL007-NANOG-sgRNA was a gift from Elzo de Wit (Addgene plasmid # 175555 ; http://n2t.net/addgene:175555 ; RRID:Addgene_175555) -
For your References section:
WAPL maintains a cohesin loading cycle to preserve cell-type-specific distal gene regulation. Liu NQ, Maresca M, van den Brand T, Braccioli L, Schijns MMGA, Teunissen H, Bruneau BG, Nora EP, de Wit E. Nat Genet. 2021 Jan;53(1):100-109. doi: 10.1038/s41588-020-00744-4. Epub 2020 Dec 14. 10.1038/s41588-020-00744-4 PubMed 33318687