FRB-polySH33-EGFP
(Plasmid
#175792)
-
PurposeBacterial expression and purification, fluorescently tagged scaffold for droplet visualization and volume quantification
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175792 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMTTH
-
Backbone manufacturerlab stock
- Backbone size w/o insert (bp) 5300
- Total vector size (bp) 7106
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsPick BL21 colony, inoculate into 10mL LB/amp, grow at 37C/220rpm overnight. Spin down overnight growth, resuspend in 10mL 50mM tris pH 8, 150mM NaCl, inoculate 3mL into 1L flask, grown at 37C/200rpm to OD~0.7, cool to 18C, and induce for 16hrs at 18C/180rpm with 1mM IPTG
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNCK1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1806
-
Entrez GeneNCK1 (a.k.a. NCK, NCKalpha, nck-1)
- Promoter tac
-
Tags
/ Fusion Proteins
- MBP (N terminal on backbone)
- His6 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
- 3′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FRB-polySH33-EGFP was a gift from Michael Rosen (Addgene plasmid # 175792 ; http://n2t.net/addgene:175792 ; RRID:Addgene_175792) -
For your References section:
Mechanistic dissection of increased enzymatic rate in a phase-separated compartment. Peeples W, Rosen MK. Nat Chem Biol. 2021 Jun;17(6):693-702. doi: 10.1038/s41589-021-00801-x. Epub 2021 May 25. 10.1038/s41589-021-00801-x PubMed 34035521