Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pNOC_hfnCas12a-Nlux
(Plasmid #176239)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176239 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC19
  • Vector type
    CRISPR, Luciferase, Synthetic Biology ; Expression in microalgae Nannochloropsis oceanica
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    humanized fnCas12a
  • Species
    Francisella novicida
  • Promoter Ribosomal subunit
  • Tag / Fusion Protein
    • luciferase (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCTACTCGTCTCTCTTGG
  • 3′ sequencing primer GCTCGAGGGTTGCGTGTGTAT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The backbone of plasmid was a gift from Eva Farre from Michigan State University. And the Cas12a sequence was obtained from the Addgene plasmid # 69976

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNOC_hfnCas12a-Nlux was a gift from John van der Oost (Addgene plasmid # 176239 ; http://n2t.net/addgene:176239 ; RRID:Addgene_176239)
  • For your References section:

    Comprehensive Genome Engineering Toolbox for Microalgae Nannochloropsis oceanica Based on CRISPR-Cas Systems. Naduthodi MIS, Sudfeld C, Avitzigiannis EK, Trevisan N, van Lith E, Alcaide Sancho J, D'Adamo S, Barbosa M, van der Oost J. ACS Synth Biol. 2021 Dec 17;10(12):3369-3378. doi: 10.1021/acssynbio.1c00329. Epub 2021 Nov 18. 10.1021/acssynbio.1c00329 PubMed 34793143