pNOC_hfnCas12a-Nlux
(Plasmid
#176239)
-
PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux under the control of Ribi promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176239 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
-
Vector typeCRISPR, Luciferase, Synthetic Biology ; Expression in microalgae Nannochloropsis oceanica
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehumanized fnCas12a
-
SpeciesFrancisella novicida
- Promoter Ribosomal subunit
-
Tag
/ Fusion Protein
- luciferase (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCTACTCGTCTCTCTTGG
- 3′ sequencing primer GCTCGAGGGTTGCGTGTGTAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe backbone of plasmid was a gift from Eva Farre from Michigan State University. And the Cas12a sequence was obtained from the Addgene plasmid # 69976
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNOC_hfnCas12a-Nlux was a gift from John van der Oost (Addgene plasmid # 176239 ; http://n2t.net/addgene:176239 ; RRID:Addgene_176239) -
For your References section:
Comprehensive Genome Engineering Toolbox for Microalgae Nannochloropsis oceanica Based on CRISPR-Cas Systems. Naduthodi MIS, Sudfeld C, Avitzigiannis EK, Trevisan N, van Lith E, Alcaide Sancho J, D'Adamo S, Barbosa M, van der Oost J. ACS Synth Biol. 2021 Dec 17;10(12):3369-3378. doi: 10.1021/acssynbio.1c00329. Epub 2021 Nov 18. 10.1021/acssynbio.1c00329 PubMed 34793143