Skip to main content

pAAV-SynI-CreOn-FlpOff-TeNT-P2A-EGFP
(Plasmid #176282)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176282 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-SynI
  • Backbone manufacturer
    Vector Builder
  • Backbone size w/o insert (bp) 4685
  • Total vector size (bp) 6842
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TeNT-P2A-EGFP
  • Alt name
    Tetanus toxin
  • Species
    Synthetic
  • Promoter human Synapsin I

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

During the synthesis a point mutation was introduced in EGFP (E5D) but this did not significantly affect fluorescence or detection by commercial antibodies.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-SynI-CreOn-FlpOff-TeNT-P2A-EGFP was a gift from Martin Riccomagno (Addgene plasmid # 176282 ; http://n2t.net/addgene:176282 ; RRID:Addgene_176282)
  • For your References section:

    ExBoX - a simple Boolean exclusion strategy to drive expression in neurons. Ubina T, Vahedi-Hunter T, Agnew-Svoboda W, Wong W, Gupta A, Santhakumar V, Riccomagno MM. J Cell Sci. 2021 Oct 15;134(20). pii: 272538. doi: 10.1242/jcs.257212. Epub 2021 Oct 20. 10.1242/jcs.257212 PubMed 34515305