-
PurposeCMV-HIVNES-GS-Cas13bt1 (human codon optimized Cas13bt1 expression)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176316 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Total vector size (bp) 7833
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman codon optimized Cas13bt1
-
SpeciesAtlantic deep subsurface metagenome
-
Insert Size (bp)2409
- Promoter CMV
-
Tag
/ Fusion Protein
- HIV NES (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer taatacgactcactataggg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAB1678 CMV-HIVNES-GS-Cas13bt1 was a gift from Feng Zhang (Addgene plasmid # 176316 ; http://n2t.net/addgene:176316 ; RRID:Addgene_176316) -
For your References section:
Compact RNA editors with small Cas13 proteins. Kannan S, Altae-Tran H, Jin X, Madigan VJ, Oshiro R, Makarova KS, Koonin EV, Zhang F. Nat Biotechnol. 2021 Aug 30. pii: 10.1038/s41587-021-01030-2. doi: 10.1038/s41587-021-01030-2. 10.1038/s41587-021-01030-2 PubMed 34462587