Skip to main content

pGFP-Ub-VPS13D_dC
(Plasmid #176466)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176466 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3679
  • Total vector size (bp) 16794
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VPS13D
  • Alt name
    SCAR4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    11871
  • Mutation
    C-terminal 407 aa is deleted.
  • GenBank ID
    NM_015378 ENSG00000048707
  • Entrez Gene
    VPS13D (a.k.a. BLTP5D, SCAR4)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP-Ub (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGAAGCGCGATCACATGG
  • 3′ sequencing primer CATTTTATGTTTCAGGTTCAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

GFP-Ub-VPS13D will be translated into one fusion protein. However, endogenous DUBs will cleave it into GFP-Ub and VPS13D fragments. GFP-Ub hence acts as a fluorescent reporter for VPS13D expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGFP-Ub-VPS13D_dC was a gift from Richard Youle (Addgene plasmid # 176466 ; http://n2t.net/addgene:176466 ; RRID:Addgene_176466)
  • For your References section:

    VPS13D promotes peroxisome biogenesis. Baldwin HA, Wang C, Kanfer G, Shah HV, Velayos-Baeza A, Dulovic-Mahlow M, Bruggemann N, Anding A, Baehrecke EH, Maric D, Prinz WA, Youle RJ. J Cell Biol. 2021 May 3;220(5). pii: 212018. doi: 10.1083/jcb.202001188. 10.1083/jcb.202001188 PubMed 33891012