Skip to main content
Addgene
Open Menu

PX459-APP-KO
(Plasmid #176487)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176487 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 176487-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 176487-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    PX459
  • Vector type
    CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA sequence
  • gRNA/shRNA sequence
    CACCGGCGGAATTGACAAGTTCCGA
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX459-APP-KO was a gift from Wade Harper (Addgene plasmid # 176487 ; http://n2t.net/addgene:176487 ; RRID:Addgene_176487)

  • For your References section:

    Spatial snapshots of amyloid precursor protein intramembrane processing via early endosome proteomics. Park H, Hundley FV, Yu Q, Overmyer KA, Brademan DR, Serrano L, Paulo JA, Paoli JC, Swarup S, Coon JJ, Gygi SP, Wade Harper J. Nat Commun. 2022 Oct 16;13(1):6112. doi: 10.1038/s41467-022-33881-x. 10.1038/s41467-022-33881-x PubMed 36245040
Related items:
Commonly requested with: