Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PX459-APP-KO
(Plasmid #176487)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176487 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PX459
  • Vector type
    CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA sequence
  • gRNA/shRNA sequence
    CACCGGCGGAATTGACAAGTTCCGA
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX459-APP-KO was a gift from Wade Harper (Addgene plasmid # 176487 ; http://n2t.net/addgene:176487 ; RRID:Addgene_176487)
  • For your References section:

    Spatial snapshots of amyloid precursor protein intramembrane processing via early endosome proteomics. Park H, Hundley FV, Yu Q, Overmyer KA, Brademan DR, Serrano L, Paulo JA, Paoli JC, Swarup S, Coon JJ, Gygi SP, Wade Harper J. Nat Commun. 2022 Oct 16;13(1):6112. doi: 10.1038/s41467-022-33881-x. 10.1038/s41467-022-33881-x PubMed 36245040