Cre-p2a-tdTomato
(Plasmid
#176837)
-
PurposeExpress Cre in mammalian cells and enable FACS sorting Cre expressing cells by tdTomato expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176837 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAVS1-tdTomato
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre-P2A-tdTomato
- Promoter CAGGS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer attgtgctgtctcatcattttggc
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.03.24.485641v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cre-p2a-tdTomato was a gift from Rudolf Jaenisch (Addgene plasmid # 176837 ; http://n2t.net/addgene:176837 ; RRID:Addgene_176837) -
For your References section:
The nuclear receptor THRB facilitates differentiation of human PSCs into more mature hepatocytes. Ma H, de Zwaan E, Guo YE, Cejas P, Thiru P, van de Bunt M, Jeppesen JF, Syamala S, Dall'Agnese A, Abraham BJ, Fu D, Garrett-Engele C, Lee TI, Long HW, Griffith LG, Young RA, Jaenisch R. Cell Stem Cell. 2022 Apr 13. pii: S1934-5909(22)00150-3. doi: 10.1016/j.stem.2022.03.015. 10.1016/j.stem.2022.03.015 PubMed 35452598