Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRibo-APEX2m
(Plasmid #176842)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176842 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMV261
  • Backbone manufacturer
    Jeffery Cox Lab
  • Backbone size w/o insert (bp) 4487
  • Total vector size (bp) 5077
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    In mycobacteria use 2mM Theophylline for bacterial expression.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    pRibo-APEX2m
  • Alt name
    pRibo aka.; hsp60 based theophylline (on) riboswitch promotor
  • Alt name
    APEX2m aka.; ascorbate peroxidase 2 (codon optimized for mycobacteria)
  • Species
    mycobacteria
  • Insert Size (bp)
    1040
  • Promoter pRibo, theophilline riboswitch inducible hsp60 promoter

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGTTGTAGTGCTTGTGGTGG
  • 3′ sequencing primer CTAGCTGATCACCGCGGCCATGATGGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Apex2 sequence from Alice Ting was codon optimized for mycobacteria and ordered from Genewiz for cloning.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRibo-APEX2m was a gift from Jessica Seeliger (Addgene plasmid # 176842 ; http://n2t.net/addgene:176842 ; RRID:Addgene_176842)
  • For your References section:

    Optimized APEX2 peroxidase-mediated proximity labeling in fast- and slow-growing mycobacteria. Ahamed M, Jaisinghani N, Li M, Winkeler I, Silva S, Previti ML, Seeliger JC. Methods Enzymol. 2022;664:267-289. doi: 10.1016/bs.mie.2021.11.021. Epub 2021 Dec 30. 10.1016/bs.mie.2021.11.021 PubMed 35331378