Skip to main content

pRiboI-APEX2m
(Plasmid #176843)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176843 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMV306
  • Backbone manufacturer
    Jeffery Cox Lab
  • Backbone size w/o insert (bp) 3981
  • Total vector size (bp) 4961
  • Vector type
    Bacterial Expression ; Integrating

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    In mycobacteria use 2mM theophilline to induce gene expression
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    pRibo-APEX2m
  • Alt name
    pRibo aka.; hsp60 based theophylline (on) riboswitch promotor
  • Alt name
    Apex2m aka. ascorbate peroxidase 2 (mycobacterial codon optimized)
  • Species
    mycobacteria
  • Insert Size (bp)
    1144
  • Promoter pRibo, theophilline riboswitch inducible hsp60 promoter

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCCTTTGAGTGAGCTGATACC
  • 3′ sequencing primer GATGGCATAAAACGAAAGGCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Apex2 from Alice Ting was codon optimized for mycobacteria and ordered from genewiz.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains an E151V mutation in the int feature. This mutation is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRiboI-APEX2m was a gift from Jessica Seeliger (Addgene plasmid # 176843 ; http://n2t.net/addgene:176843 ; RRID:Addgene_176843)
  • For your References section:

    Optimized APEX2 peroxidase-mediated proximity labeling in fast- and slow-growing mycobacteria. Ahamed M, Jaisinghani N, Li M, Winkeler I, Silva S, Previti ML, Seeliger JC. Methods Enzymol. 2022;664:267-289. doi: 10.1016/bs.mie.2021.11.021. Epub 2021 Dec 30. 10.1016/bs.mie.2021.11.021 PubMed 35331378