pRiboI-APEX2m
(Plasmid
#176843)
-
PurposeExpression of APEX2 from a codon-optimized gene (single-copy integrating plasmid)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176843 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMV306
-
Backbone manufacturerJeffery Cox Lab
- Backbone size w/o insert (bp) 3981
- Total vector size (bp) 4961
-
Vector typeBacterial Expression ; Integrating
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsIn mycobacteria use 2mM theophilline to induce gene expression
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namepRibo-APEX2m
-
Alt namepRibo aka.; hsp60 based theophylline (on) riboswitch promotor
-
Alt nameApex2m aka. ascorbate peroxidase 2 (mycobacterial codon optimized)
-
Speciesmycobacteria
-
Insert Size (bp)1144
- Promoter pRibo, theophilline riboswitch inducible hsp60 promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCCTTTGAGTGAGCTGATACC
- 3′ sequencing primer GATGGCATAAAACGAAAGGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byApex2 from Alice Ting was codon optimized for mycobacteria and ordered from genewiz.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains an E151V mutation in the int feature. This mutation is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRiboI-APEX2m was a gift from Jessica Seeliger (Addgene plasmid # 176843 ; http://n2t.net/addgene:176843 ; RRID:Addgene_176843) -
For your References section:
Optimized APEX2 peroxidase-mediated proximity labeling in fast- and slow-growing mycobacteria. Ahamed M, Jaisinghani N, Li M, Winkeler I, Silva S, Previti ML, Seeliger JC. Methods Enzymol. 2022;664:267-289. doi: 10.1016/bs.mie.2021.11.021. Epub 2021 Dec 30. 10.1016/bs.mie.2021.11.021 PubMed 35331378