pRibo-Sec-APEX2m
(Plasmid
#176844)
-
PurposeExpression of APEX2 in the periplasm from a codon-optimized gene (multi-copy episomal plasmid)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176844 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMV261
-
Backbone manufacturerJeffery Cox Lab
- Backbone size w/o insert (bp) 4487
- Total vector size (bp) 5258
-
Vector typeBacterial Expression ; Inducible
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsTo induce gene expression in mycobacteria add theophylline to 2mM.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namepRibo-Sec-APEX2m
-
Alt namepRibo aka.; hsp60 based theophylline (on) riboswitch promotor
-
Alt nameSec aka; Sec signal; secretion signal from Mpt63 mycobacterial protein
-
Alt nameAPEX2m aka.; ascorbate peroxidase 2 (codon optimized for mycobacteria)
-
Speciesmycobacteria
-
Insert Size (bp)1141
- Promoter pRibo, theophilline riboswitch inducible hsp60 promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGTTGTAGTGCTTGTGGTGG
- 3′ sequencing primer CTAGCTGATCACCGCGGCCATGATGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byapex2 gene from Alice Ting Lab was codon optimized for mycobacteria and ordered from Genewiz.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRibo-Sec-APEX2m was a gift from Jessica Seeliger (Addgene plasmid # 176844 ; http://n2t.net/addgene:176844 ; RRID:Addgene_176844) -
For your References section:
Optimized APEX2 peroxidase-mediated proximity labeling in fast- and slow-growing mycobacteria. Ahamed M, Jaisinghani N, Li M, Winkeler I, Silva S, Previti ML, Seeliger JC. Methods Enzymol. 2022;664:267-289. doi: 10.1016/bs.mie.2021.11.021. Epub 2021 Dec 30. 10.1016/bs.mie.2021.11.021 PubMed 35331378