pRiboI-Sec-APEX2m
(Plasmid
#176845)
-
PurposeExpression of APEX2 in the periplasm from a codon-optimized gene (single-copy integrating plasmid)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176845 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMV306
-
Backbone manufacturerJeffery Cox Lab
- Backbone size w/o insert (bp) 3981
- Total vector size (bp) 5086
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsWhen the plasmid is used in mycobacteria, add theophylline to a maximum of 2mM to promote gene expression.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namepRibo-Sec-APEX2m
-
Alt namepRibo aka.; hsp60 based theophylline (on) riboswitch promotor
-
Alt nameSec aka; Sec signal; secretion signal from Mpt63 mycobacterial protein
-
Alt nameAPEX2m aka.; ascorbate peroxidase 2 (codon optimized for mycobacteria)
-
Insert Size (bp)1183
- Promoter pRibo, theophilline riboswitch inducible hsp60 promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCCTTTGAGTGAGCTGATACC
- 3′ sequencing primer GATGGCATAAAACGAAAGGCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bymycobacterial codon optimized sequence of Apex2 from Alice Ting Lab. Ordered gene from Genewiz.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains an E151V mutation in the int feature. This mutation is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRiboI-Sec-APEX2m was a gift from Jessica Seeliger (Addgene plasmid # 176845 ; http://n2t.net/addgene:176845 ; RRID:Addgene_176845) -
For your References section:
Optimized APEX2 peroxidase-mediated proximity labeling in fast- and slow-growing mycobacteria. Ahamed M, Jaisinghani N, Li M, Winkeler I, Silva S, Previti ML, Seeliger JC. Methods Enzymol. 2022;664:267-289. doi: 10.1016/bs.mie.2021.11.021. Epub 2021 Dec 30. 10.1016/bs.mie.2021.11.021 PubMed 35331378