Skip to main content
Addgene

pSBbi-moxGFP-P2A-T2A-Puro
(Plasmid #176893)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176893 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSBbi-Pur (Addgene Plasmid #60523)
  • Backbone manufacturer
    Eric Kowarz
  • Backbone size w/o insert (bp) 5857
  • Total vector size (bp) 6496
  • Modifications to backbone
    Insertion of moxGFP-P2A-T2A construct
  • Vector type
    Mammalian Expression ; Transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    moxGFP-P2A-T2A
  • Species
    Synthetic
  • Insert Size (bp)
    864
  • GenBank ID
  • Promoter EF1a/RPBSA
  • Tags / Fusion Proteins
    • moxGFP (N terminal on insert)
    • moxGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GCCTCAGACAGTGGTTCAAAG
  • 3′ sequencing primer AGGCACAGTCGAGGCTGAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The moxGFP-P2A-T2A construct was designed by Jorge L. Arias-Arias from Universidad de Costa Rica ([email protected]) It was codon optimized for human and mouse expression and includes two additional cloning sites (5' EcoRV - 3' SalI and 5' SmaI - 3' XbaI, see the map uploaded by the depositor) for the polycistronic expression of up to three genes: moxGFP and two more. This vector is suitable for transient transfection, but it was intended to be co-transfected with the transposase vector pCMV(CAT)T7-SB100 (Addgene Plasmid #34879) in order to generate mammalian cells with stable expression of the genes of interest. Enjoy!

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBbi-moxGFP-P2A-T2A-Puro was a gift from Jorge Luis Arias-Arias (Addgene plasmid # 176893 ; http://n2t.net/addgene:176893 ; RRID:Addgene_176893)
  • For your References section:

    MYC dosage compensation is mediated by miRNA-transcription factor interactions in aneuploid cancer. Acon M, Geiss C, Torres-Calvo J, Bravo-Estupinan D, Oviedo G, Arias-Arias JL, Rojas-Matey LA, Edwin B, Vasquez-Vargas G, Oses-Vargas Y, Guevara-Coto J, Segura-Castillo A, Siles-Canales F, Quiros-Barrantes S, Regnier-Vigouroux A, Mendes P, Mora-Rodriguez R. iScience. 2021 Nov 8;24(12):103407. doi: 10.1016/j.isci.2021.103407. eCollection 2021 Dec 17. 10.1016/j.isci.2021.103407 PubMed 34877484