pSBbi-moxGFP-P2A-T2A-Puro
(Plasmid #176893)

• Purpose: Sleeping Beauty transposon-based vector for mammalian polycistronic expression of moxGFP and two additional genes of interest
• Depositing Lab: Jorge Luis Arias-Arias
• Publication: Acon et al iScience. 2021 Nov 8;24(12):103407. doi: 10.1016/j.isci.2021.103407. eCollection 2021 Dec 17.

Backbone

• Vector backbone: pSBbi-Pur (Addgene Plasmid #60523)
• Backbone manufacturer: Eric Kowarz
• Backbone size w/o insert (bp): 5857
• Total vector size (bp): 6496
• Modifications to backbone: Insertion of moxGFP-P2A-T2A construct
• Vector type: Mammalian Expression ; Transposon
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: moxGFP-P2A-T2A
• Species: Synthetic
• Insert Size (bp): 864
• GenBank ID:
• Promoter: EF1a/RPBSA
• Tags / Fusion Proteins:
  • moxGFP (N terminal on insert)
  • moxGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GCCTCAGACAGTGGTTCAAAG
• 3′ sequencing primer: AGGCACAGTCGAGGCTGAT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The moxGFP-P2A-T2A construct was designed by Jorge L. Arias-Arias from Universidad de Costa Rica (). It was codon optimized for human and mouse expression and includes two additional cloning sites (5' EcoRV - 3' SalI and 5' SmaI - 3' XbaI, see the map uploaded by the depositor) for the polycistronic expression of up to three genes: moxGFP and two more. This vector is suitable for transient transfection, but it was intended to be co-transfected with the transposase vector pCMV(CAT)T7-SB100 (Addgene Plasmid #34879) in order to generate mammalian cells with stable expression of the genes of interest. Enjoy!