Skip to main content

pRN3P_T3_BE3_IVT
(Plasmid #177015)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177015 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRN3P
  • Backbone manufacturer
    Torres-Padilla et al., 2007
  • Backbone size w/o insert (bp) 3091
  • Total vector size (bp) 8351
  • Vector type
    CRISPR ; Vector for in-vitro transcription

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Grow solid and liquid cultures always at 30°C
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    BE3
  • Alt name
    Cytosine Base Editor
  • Species
    Synthetic
  • Insert Size (bp)
    5260
  • Promoter T3 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamhI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer atgagctcagagactggcccag
  • 3′ sequencing primer ttagactttcctcttcttcttg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRN3P_T3_BE3_IVT was a gift from Timo Otonkoski (Addgene plasmid # 177015 ; http://n2t.net/addgene:177015 ; RRID:Addgene_177015)
  • For your References section:

    Simultaneous high-efficiency base editing and reprogramming of patient fibroblasts. Jalil S, Keskinen T, Maldonado R, Sokka J, Trokovic R, Otonkoski T, Wartiovaara K. Stem Cell Reports. 2021 Nov 16. pii: S2213-6711(21)00552-X. doi: 10.1016/j.stemcr.2021.10.017. 10.1016/j.stemcr.2021.10.017 PubMed 34822772