pJL057
(Plasmid
#177169)
-
PurposeExpresses a nuclease dead MRE11 in human cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177169 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepInducer20
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMRE11 H129N
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2125
-
Mutationnuclease-inactivating mutation (H129N)
-
Entrez GeneMRE11 (a.k.a. ATLD, HNGS1, MRE11A, MRE11B)
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cccctacccggtagaatttc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMRE11 cDNA sequence was amplified from pICE-HA-MRE11-WT (Addgene, 82033) and H129N mutation was introduced via PCR.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL057 was a gift from Brittany Adamson (Addgene plasmid # 177169 ; http://n2t.net/addgene:177169 ; RRID:Addgene_177169) -
For your References section:
Mapping the genetic landscape of DNA double-strand break repair. Hussmann JA, Ling J, Ravisankar P, Yan J, Cirincione A, Xu A, Simpson D, Yang D, Bothmer A, Cotta-Ramusino C, Weissman JS, Adamson B. Cell. 2021 Oct 28;184(22):5653-5669.e25. doi: 10.1016/j.cell.2021.10.002. Epub 2021 Oct 20. 10.1016/j.cell.2021.10.002 PubMed 34672952