mCherry-PTDSS1-IRES-puromycin-pLVx-EF1a
(Plasmid
#177435)
-
PurposeTo express mCherry fused to PTDSS1, a protein that localized to mitochondria associated ER membranes (MAMs). Lentiviral vector used to make cell lines expressing this MAM landmark.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177435 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLVX-EF1a-IRES-Puromycin
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePhosphatidylserine synthase-1, PTDSS1, LMHD, PSS1, PSSA
-
Alt namemCherry-PTDSS1, Ch-PTDSS1, ChPTDSS1
-
SpeciesH. sapiens (human)
-
Entrez GenePTDSS1 (a.k.a. LMHD, PSS1, PSSA)
- Promoter EF1a
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer aagcgcgatcacatggtcctg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPTDSS1 sequence matches Gene ID: 9791. mCherry sequence matches GenBank: AZP55984.1.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Infection with this plasmid will express mCherry-fused to the N-terminus of PTDSS1, a protein which localizes to mitochondria associated ER membranes. There is a flexible, 8 aa linker "SGLRSGTS", between mCherry and PTDSS1.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-PTDSS1-IRES-puromycin-pLVx-EF1a was a gift from David Andrews (Addgene plasmid # 177435 ; http://n2t.net/addgene:177435 ; RRID:Addgene_177435)