pDIV494
(Plasmid
#177701)
-
PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hansenii
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177701 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDIV066
- Total vector size (bp) 12820
-
Vector typeBacterial Expression, Yeast Expression, CRISPR
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCas9
-
SpeciesCTG-clade compatible
- Promoter RNR2p (Debaryomyces hansenii )
-
Tag
/ Fusion Protein
- SV40 (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CTATGGCTCCAGGTCCCGAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNat
-
SpeciesCTG-clade compatible
- Promoter TDH3p (Candida lusitaniae)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GCTTGAGAAGGTTTTGGGACG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namesgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
-
SpeciesSynthetic; CTG-Clade compatible
- Promoter SNR52p (Candida sp)
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer CTAGAAAGTATAGGAACTTCTGAAGTGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCodon optimized Cas9 was derived from another plasmid pRB732 that was obtained from Prof. Richard J. Bennett
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDIV494 was a gift from Uffe Mortensen (Addgene plasmid # 177701 ; http://n2t.net/addgene:177701 ; RRID:Addgene_177701) -
For your References section:
A CRISPR/Cas9 method facilitates efficient oligo-mediated gene editing in Debaryomyces hansenii. Strucko T, Andersen NL, Mahler MR, Martinez JL, Mortensen UH. Synth Biol (Oxf). 2021 Oct 12;6(1):ysab031. doi: 10.1093/synbio/ysab031. eCollection 2021. 10.1093/synbio/ysab031 PubMed 34746438