pEFS-ccdB-12X MS2_mPGK-Puro
(Plasmid #177809)

• Purpose: (Empty Backbone) Assembly backbone for tagging RNA transcript with a 12X tandem MS2 stemloop at the 3'
• Depositing Lab: Sven Eyckerman
• Publication: Delhaye et al Sci Rep. 2022 Jan 27;12(1):1513. doi: 10.1038/s41598-022-05405-6.

Backbone

• Vector backbone: pUC19
• Backbone size (bp): 2686
• Vector type: Mammalian Expression
• Promoter: EFS
• Selectable markers: Puromycin
• Tag / Fusion Protein:
  • 12X MS2 stem loops (C terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: TAAGTTGGGTAACGCCAGGG
• 3′ sequencing primer: GCTCGTATGTTGTGTGGAAT

Resource Information

• Supplemental Documents:
  • pEFS-ccdB-12X MS2_mPGK-Puro

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was designed to tag transcripts of insert at the 3' with an 12X MS2 stem loop tag. Insertion of the transcript of interst is performed by BsaI cloning.
5' BsaI generates ACAG overhang (BsaI recognition site 2659-2664)
3' BsaI generates CCCG overhang (BsaI recognition site 4086-4091)

These BsaI sites are lost upon insertion of the transcript of interest.