pJC7
              
              
                (Plasmid
                
                #177872)
              
            
            
            
          - 
            Purpose(Empty Backbone) Co-express in mammalian cells two target proteins, using an internal ribosome entry site and two multi-cloning sites.
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177872 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepJC7
 - Backbone size (bp) 5129
 - 
              Vector typeMammalian Expression
 - Promoter CMV
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ sequencing primer site 2- IRES for: ggtgcacatgctttacgtgt
 - 3′ sequencing primer site 2- WPRE rev: atccacatagcgtaaaaggagc (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
Depositor Comments
Additional primers for Site 1 are provided below:
5’ seq primer: site 1- CMV for: CGCAAATGGGCGGTAGGCGTG
3’ seq primer: site 1- IRES rev: acaccggccttattccaag
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pJC7 was a gift from Roberto Dominguez (Addgene plasmid # 177872 ; http://n2t.net/addgene:177872 ; RRID:Addgene_177872) - 
                
For your References section:
Novel human cell expression method reveals the role and prevalence of posttranslational modification in nonmuscle tropomyosins. Carman PJ, Barrie KR, Dominguez R. J Biol Chem. 2021 Oct;297(4):101154. doi: 10.1016/j.jbc.2021.101154. Epub 2021 Sep 1. 10.1016/j.jbc.2021.101154 PubMed 34478714