Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #162795)


Item Catalog # Description Quantity Price (USD)
Plasmid 162795 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5011
  • Total vector size (bp) 6004
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Human rhinovirus 14 3C protease
  • Alt name
  • Species
    Human rhinovirus 14 3C
  • Insert Size (bp)
  • GenBank ID
  • Promoter T7
  • Tag / Fusion Protein
    • NT* solubility tag (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-NT*-HRV3CP was a gift from Gottfried Otting (Addgene plasmid # 162795 ; ; RRID:Addgene_162795)
  • For your References section:

    NT*-HRV3CP: an optimized construct of human rhinovirus 14 3C protease for high-yield expression and fast affinity-tag cleavage. Abdelkader EH, Otting G. J Biotechnol. 2020 Nov 6. pii: S0168-1656(20)30306-0. doi: 10.1016/j.jbiotec.2020.11.005. 10.1016/j.jbiotec.2020.11.005 PubMed 33166527