-
Purpose(Empty Backbone) Expresses sgRNA and can be packaged into AAV particles for somatic delivery into Cas9 transgenic mice
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177935 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonescAAV vector
-
Vector typeMammalian Expression, AAV, CRISPR
- Promoter U6
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Expresses EGFP marker
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
scAAV-sgRNA-GFP was a gift from Roland Rad (Addgene plasmid # 177935 ; http://n2t.net/addgene:177935 ; RRID:Addgene_177935) -
For your References section:
CRISPR somatic genome engineering and cancer modeling in the mouse pancreas and liver. Kaltenbacher T, Loprich J, Maresch R, Weber J, Muller S, Oellinger R, Gross N, Griger J, de Andrade Kratzig N, Avramopoulos P, Ramanujam D, Brummer S, Widholz SA, Barthel S, Falcomata C, Pfaus A, Alnatsha A, Mayerle J, Schmidt-Supprian M, Reichert M, Schneider G, Ehmer U, Braun CJ, Saur D, Engelhardt S, Rad R. Nat Protoc. 2022 Apr;17(4):1142-1188. doi: 10.1038/s41596-021-00677-0. Epub 2022 Mar 14. 10.1038/s41596-021-00677-0 PubMed 35288718