-
PurposeExpression human RAP containing a C-terminal 6xHis tag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177986 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEZT-BM
-
Backbone manufacturerRyan Hibbs
- Backbone size w/o insert (bp) 7427
- Total vector size (bp) 8519
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLDL receptor related protein associated protein 1
-
Alt nameLRPAP1
-
Alt nameRAP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1092
-
GenBank IDNM_002337
-
Entrez GeneLRPAP1 (a.k.a. A2MRAP, A2RAP, HBP44, MRAP, MYP23, RAP, alpha-2-MRAP)
- Promoter CMV
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CACTCCCAGTTCAATTAC
- 3′ sequencing primer ACAAATTTTGTAATCCAGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hRAP-pEZT-BM was a gift from Lora Hooper (Addgene plasmid # 177986 ; http://n2t.net/addgene:177986 ; RRID:Addgene_177986) -
For your References section:
Serum amyloid A delivers retinol to intestinal myeloid cells to promote adaptive immunity. Bang YJ, Hu Z, Li Y, Gattu S, Ruhn KA, Raj P, Herz J, Hooper LV. Science. 2021 Sep 17;373(6561):eabf9232. doi: 10.1126/science.abf9232. Epub 2021 Sep 17. 10.1126/science.abf9232 PubMed 34529485