4xHRE_RE:RedF
(Plasmid
#178314)
-
PurposeHRE RedFirefly luciferase reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178314 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAlpha 1 Vector
-
Backbone manufacturerVenken Lab, #118044
- Backbone size w/o insert (bp) 2326
- Total vector size (bp) 4583
-
Vector typeMammalian Expression, Luciferase, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHRE RedFirefly reporter
-
Alt nameTranscription Blocker + 4 copies of the HRE DNA binding motif + miniP, RedFirefly Luciferase
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2256
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer aatgagctgatttaacaaaaatttaacgcg
- 3′ sequencing primer ctttttacggttcctggccttttg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
4xHRE_RE:RedF was a gift from Koen Venken (Addgene plasmid # 178314 ; http://n2t.net/addgene:178314 ; RRID:Addgene_178314) -
For your References section:
Synthetic Assembly DNA Cloning of Multiplex Hextuple Luciferase Reporter Plasmids. Sarrion-Perdigones A, Gonzalez Y, Venken KJT. Methods Mol Biol. 2022;2524:409-432. doi: 10.1007/978-1-0716-2453-1_32. 10.1007/978-1-0716-2453-1_32 PubMed 35821490