6xAP-1_RE::Renilla
(Plasmid
#178317)
-
PurposeAP-1 Renilla luciferase reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178317 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAlpha C Vector
-
Backbone manufacturerVenken Lab, #124525
- Backbone size w/o insert (bp) 2326
- Total vector size (bp) 3844
-
Vector typeMammalian Expression, Luciferase, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAP-1 Renilla Reporter
-
Alt nameTranscription Blocker + 6 copies of the AP-1 DNA binding motif + miniP, Renilla Luciferase
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1518
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer aatgagctgatttaacaaaaatttaacgcg
- 3′ sequencing primer ctttttacggttcctggccttttg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
6xAP-1_RE::Renilla was a gift from Koen Venken (Addgene plasmid # 178317 ; http://n2t.net/addgene:178317 ; RRID:Addgene_178317) -
For your References section:
Synthetic Assembly DNA Cloning of Multiplex Hextuple Luciferase Reporter Plasmids. Sarrion-Perdigones A, Gonzalez Y, Venken KJT. Methods Mol Biol. 2022;2524:409-432. doi: 10.1007/978-1-0716-2453-1_32. 10.1007/978-1-0716-2453-1_32 PubMed 35821490