Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

7xSMAD_RE::GrRenilla
(Plasmid #178319)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 178319 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Alpha E Vector
  • Backbone manufacturer
    Venken Lab, #124527
  • Backbone size w/o insert (bp) 2326
  • Total vector size (bp) 3878
  • Vector type
    Mammalian Expression, Luciferase, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SMAD GreenRenilla Reporter
  • Alt name
    Transcription Blocker + 7 copies of the SMAD DNA binding motif + miniP, GreenRenilla Luciferase
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1551

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer aatgagctgatttaacaaaaatttaacgcg
  • 3′ sequencing primer ctttttacggttcctggccttttg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    7xSMAD_RE::GrRenilla was a gift from Koen Venken (Addgene plasmid # 178319 ; http://n2t.net/addgene:178319 ; RRID:Addgene_178319)
  • For your References section:

    Synthetic Assembly DNA Cloning of Multiplex Hextuple Luciferase Reporter Plasmids. Sarrion-Perdigones A, Gonzalez Y, Venken KJT. Methods Mol Biol. 2022;2524:409-432. doi: 10.1007/978-1-0716-2453-1_32. 10.1007/978-1-0716-2453-1_32 PubMed 35821490