MLRV3:HRE-P53-MAPK/JNK-FOXO-TGFβ
(Plasmid
#178320)
-
PurposeMultiplex luciferase reporter vector, with luciferase reporters for the pathways HRE, P53, AP-1, FOXO and SMAD.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178320 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneOmega Destination-CMV:ELuc:bgH
-
Backbone manufacturerVenken Lab, #124528
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 13678
-
Vector typeMammalian Expression, Luciferase, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameHRE RedFirefly reporter
-
Alt nameTranscription Blocker + 4 copies of the HRE DNA binding motif + miniP, RedFirefly Luciferase
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2256
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer actccacccattgacgtcaatggaaag
- 3′ sequencing primer agaatggcgccgggcctttc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameP53 FLuc reporter
-
Alt nameTranscription Blocker + 2 copies of the P53 DNA binding motif + miniP, Firefly Luciferase
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2218
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer caagaagcccgtggccaagatg
- 3′ sequencing primer cggggtcataaaccttggaagtcattg
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameAP-1 Renilla reporter
-
Alt nameTranscription Blocker + 6 copies of the AP-1 DNA binding motif + miniP, Renilla Luciferase
-
Insert Size (bp)1518
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer agggcggaaagatcgccgtg
- 3′ sequencing primer CGAAGTCCTCCAAGGTAAACACCATTG
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameFOXO NLuc Reporter
-
Alt nameTranscription Blocker + 3 copies of the DBE DNA binding motif + miniP, NLuc Luciferase
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1123
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GTCCTGAAGAACGAACAGTGAGCTTC
- 3′ sequencing primer CTGGGTCGTAGACTTTGGAAGCC
- (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameSMAD GrRenilla reporter
-
Alt nameTranscription Blocker + 7 copies of the SMAD DNA binding motif + miniP, Green Renilla Luciferase
-
Insert Size (bp)1552
Cloning Information for Gene/Insert 5
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GAGGCTCTGCGAACGAATACTCG
- 3′ sequencing primer ctt ttt acg gtt cct ggc ctt ttg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MLRV3:HRE-P53-MAPK/JNK-FOXO-TGFβ was a gift from Koen Venken (Addgene plasmid # 178320 ; http://n2t.net/addgene:178320 ; RRID:Addgene_178320) -
For your References section:
Synthetic Assembly DNA Cloning of Multiplex Hextuple Luciferase Reporter Plasmids. Sarrion-Perdigones A, Gonzalez Y, Venken KJT. Methods Mol Biol. 2022;2524:409-432. doi: 10.1007/978-1-0716-2453-1_32. 10.1007/978-1-0716-2453-1_32 PubMed 35821490