ER-CanlonicSF
(Plasmid
#178343)
-
PurposeTo explore endoplasmic reticulum lactate dynamics
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178343 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV-myc-ER
-
Backbone manufacturerThermo Scientific
- Backbone size w/o insert (bp) 5051
- Total vector size (bp) 6806
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameER-CanlonicSF
-
Alt nameER Targeted Calcium-and-Lactate Optical Nano-Indicator from CECs Single Fluorophore
-
SpeciesSynthetic
-
Insert Size (bp)1755
- Promoter CMV
-
Tags
/ Fusion Proteins
- ER Signal Exon 1 (N terminal on insert)
- ER Signal Exon 2 (N terminal on insert)
- ER Retention Signal (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.10.01.322404v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ER-CanlonicSF was a gift from Alejandro San Martín (Addgene plasmid # 178343 ; http://n2t.net/addgene:178343 ; RRID:Addgene_178343) -
For your References section:
Single-Fluorophore Indicator to Explore Cellular and Sub-cellular Lactate Dynamics. Aburto C, Galaz A, Bernier A, Sandoval PY, Holtheuer-Gallardo S, Ruminot I, Soto-Ojeda I, Hertenstein H, Schweizer JA, Schirmeier S, Pastor TP, Mardones GA, Barros LF, San Martin A. ACS Sens. 2022 Oct 28. doi: 10.1021/acssensors.2c00731. 10.1021/acssensors.2c00731 PubMed 36306435