Skip to main content

MDH1-shDusp5-2-H2Kb2
(Plasmid #17853)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 17853 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MDH1-404-H2Kb2
  • Backbone manufacturer
    Chen lab
  • Backbone size w/o insert (bp) 8200
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shDusp5
  • Alt name
    Dusp5
  • Species
    H. sapiens (human)
  • Entrez Gene
    DUSP5 (a.k.a. DUSP, HVH3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site See map (not destroyed)
  • 3′ cloning site See map (not destroyed)
  • 5′ sequencing primer H1
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Target region of DUSP5: CAAGGGGAGGCAGCCAGCTCCACGTTTAT (XM_140740: 1197-1225, CDS).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MDH1-shDusp5-2-H2Kb2 was a gift from Chang-Zheng Chen (Addgene plasmid # 17853 ; http://n2t.net/addgene:17853 ; RRID:Addgene_17853)
  • For your References section:

    miR-181a is an intrinsic modulator of T cell sensitivity and selection. Li QJ, Chau J, Ebert PJ, Sylvester G, Min H, Liu G, Braich R, Manoharan M, Soutschek J, Skare P, Klein LO, Davis MM, Chen CZ. Cell. 2007 Apr 6. 129(1):147-61. 10.1016/j.cell.2007.03.008 PubMed 17382377