Skip to main content

pCAG-RFP-p2a-postASAP
(Plasmid #178793)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178793 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 5466
  • Total vector size (bp) 7821
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FingR.PSD95, ASAP2f and TagRFP
  • Alt name
    accelerated sensor of action potentials 2f
  • Species
    Synthetic
  • Insert Size (bp)
    2355
  • Mutation
    mutations in amino acids L146G, S147T N149R, S150G, H151D, T399R of ASAP2f
  • Promoter CAG
  • Tag / Fusion Protein
    • TagRFP

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer taccggtaggccaccatggtgtctaagggcgaagagct
  • 3′ sequencing primer cttgacttcgagcatgggaccggggttttcttcca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-RFP-p2a-postASAP was a gift from Rafael Yuste (Addgene plasmid # 178793 ; http://n2t.net/addgene:178793 ; RRID:Addgene_178793)
  • For your References section:

    Voltage compartmentalization in dendritic spines in vivo. Cornejo VH, Ofer N, Yuste R. Science. 2022 Jan 7;375(6576):82-86. doi: 10.1126/science.abg0501. Epub 2021 Nov 11. 10.1126/science.abg0501 PubMed 34762487