pCAG-postASAP-p2a-ChrimsonR
(Plasmid
#178794)
-
PurposeExpresses voltage sensor targeted to dendrites and spines along with ChrimsonR
-
Depositing Lab
-
Depositing OrganizationColumbia University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178794 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 178794-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 178794-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 6097
- Total vector size (bp) 9502
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFingR.PSD95, ASAP2f and ChrimsonR
-
Alt nameaccelerated sensor of action potentials 2f
-
SpeciesSynthetic
-
Insert Size (bp)4076
-
Mutationmutations in amino acids L146G, S147T N149R, S150G, H151D, T399R of ASAP2f
- Promoter CAG
-
Tag
/ Fusion Protein
- mRuby2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cttgaagtggtaaccggctccggagcc
- 3′ sequencing primer taccaagctttcattacttgtacagctcg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 178794-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 178794-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-postASAP-p2a-ChrimsonR was a gift from Rafael Yuste (Addgene plasmid # 178794 ; http://n2t.net/addgene:178794 ; RRID:Addgene_178794) -
For your References section:
Voltage compartmentalization in dendritic spines in vivo. Cornejo VH, Ofer N, Yuste R. Science. 2022 Jan 7;375(6576):82-86. doi: 10.1126/science.abg0501. Epub 2021 Nov 11. 10.1126/science.abg0501 PubMed 34762487
Map uploaded by the depositor.
