Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAG-postASAP-p2a-ChrimsonR
(Plasmid #178794)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 178794 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 6097
  • Total vector size (bp) 9502
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FingR.PSD95, ASAP2f and ChrimsonR
  • Alt name
    accelerated sensor of action potentials 2f
  • Species
    Synthetic
  • Insert Size (bp)
    4076
  • Mutation
    mutations in amino acids L146G, S147T N149R, S150G, H151D, T399R of ASAP2f
  • Promoter CAG
  • Tag / Fusion Protein
    • mRuby2

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cttgaagtggtaaccggctccggagcc
  • 3′ sequencing primer taccaagctttcattacttgtacagctcg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-postASAP-p2a-ChrimsonR was a gift from Rafael Yuste (Addgene plasmid # 178794 ; http://n2t.net/addgene:178794 ; RRID:Addgene_178794)
  • For your References section:

    Voltage compartmentalization in dendritic spines in vivo. Cornejo VH, Ofer N, Yuste R. Science. 2022 Jan 7;375(6576):82-86. doi: 10.1126/science.abg0501. Epub 2021 Nov 11. 10.1126/science.abg0501 PubMed 34762487