Skip to main content
Addgene

TDG004_pLenti_CMVtight_Kir2.1_CFP
(Plasmid #178820)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178820 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti
  • Total vector size (bp) 10015
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kir2.1_CFP
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2046
  • GenBank ID
    kir2.1 NM_008425.4
  • Promoter CMV
  • Tag / Fusion Protein
    • CFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV-forward: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer WPRE-R: CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2021.11.22.469481 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TDG004_pLenti_CMVtight_Kir2.1_CFP was a gift from Adam Cohen (Addgene plasmid # 178820 ; http://n2t.net/addgene:178820 ; RRID:Addgene_178820)
  • For your References section:

    Video-based pooled screening yields improved far-red genetically encoded voltage indicators. Tian H, Davis HC, Wong-Campos JD, Park P, Fan LZ, Gmeiner B, Begum S, Werley CA, Borja GB, Upadhyay H, Shah H, Jacques J, Qi Y, Parot V, Deisseroth K, Cohen AE. Nat Methods. 2023 Jul;20(7):1082-1094. doi: 10.1038/s41592-022-01743-5. Epub 2023 Jan 9. 10.1038/s41592-022-01743-5 PubMed 36624211