TDG004_pLenti_CMVtight_Kir2.1_CFP
(Plasmid
#178820)
-
Purposetet-on expression of an inward-rectifier potassium channel Kir2.1 carrying an CFP tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178820 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti
- Total vector size (bp) 10015
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKir2.1_CFP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2046
-
GenBank IDkir2.1 NM_008425.4
-
Entrez GeneKcnj2 (a.k.a. IRK1, Kcnf1, Kir2.1)
- Promoter CMV
-
Tag
/ Fusion Protein
- CFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV-forward: CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer WPRE-R: CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2021.11.22.469481 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TDG004_pLenti_CMVtight_Kir2.1_CFP was a gift from Adam Cohen (Addgene plasmid # 178820 ; http://n2t.net/addgene:178820 ; RRID:Addgene_178820) -
For your References section:
Video-based pooled screening yields improved far-red genetically encoded voltage indicators. Tian H, Davis HC, Wong-Campos JD, Park P, Fan LZ, Gmeiner B, Begum S, Werley CA, Borja GB, Upadhyay H, Shah H, Jacques J, Qi Y, Parot V, Deisseroth K, Cohen AE. Nat Methods. 2023 Jul;20(7):1082-1094. doi: 10.1038/s41592-022-01743-5. Epub 2023 Jan 9. 10.1038/s41592-022-01743-5 PubMed 36624211