Skip to main content

HT114_Fsyn_FAS(Cre off)_QuasAr6b_Citrine
(Plasmid #178825)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178825 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Fsyn
  • Total vector size (bp) 10266
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    QuasAr6b_citrine
  • Species
    Synthetic
  • Insert Size (bp)
    1752
  • Promoter hSyn
  • Tag / Fusion Protein
    • citrine (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer hSyn_F: GAGGAGTCGTGTCGTGCCTG
  • 3′ sequencing primer WPRE_R: CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2021.11.22.469481 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HT114_Fsyn_FAS(Cre off)_QuasAr6b_Citrine was a gift from Adam Cohen (Addgene plasmid # 178825 ; http://n2t.net/addgene:178825 ; RRID:Addgene_178825)
  • For your References section:

    Video-based pooled screening yields improved far-red genetically encoded voltage indicators. Tian H, Davis HC, Wong-Campos JD, Park P, Fan LZ, Gmeiner B, Begum S, Werley CA, Borja GB, Upadhyay H, Shah H, Jacques J, Qi Y, Parot V, Deisseroth K, Cohen AE. Nat Methods. 2023 Jul;20(7):1082-1094. doi: 10.1038/s41592-022-01743-5. Epub 2023 Jan 9. 10.1038/s41592-022-01743-5 PubMed 36624211