MYR-FR-C2D-EGFR
(Plasmid
#179262)
-
PurposeLight-induced clustering of EGFR cytosolic domains
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179262 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
- Total vector size (bp) 13537
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEGFR
-
Alt nameERBB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1629
-
Entrez GeneEGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, NNCIS, PIG61, mENA)
- Promoter SFFV
-
Tags
/ Fusion Proteins
- FusionRed (N terminal on insert)
- Cry2 PHR (N terminal on insert)
- Myristoylation sequence (MYR) (N terminal on insert)
- FUS (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccgacagactgagtcgcccggg
- 3′ sequencing primer ccagaggttgattatcgataagc
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MYR-FR-C2D-EGFR was a gift from Jared Toettcher (Addgene plasmid # 179262 ; http://n2t.net/addgene:179262 ; RRID:Addgene_179262) -
For your References section:
Substratum stiffness regulates Erk signaling dynamics through receptor-level control. Farahani PE, Lemke SB, Dine E, Uribe G, Toettcher JE, Nelson CM. Cell Rep. 2021 Dec 28;37(13):110181. doi: 10.1016/j.celrep.2021.110181. 10.1016/j.celrep.2021.110181 PubMed 34965432