Skip to main content

pOUPc-UL148-mCherry
(Plasmid #179279)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179279 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pOUPc
  • Backbone manufacturer
    derived from Steven Elledge lab's pInducer20
  • Backbone size w/o insert (bp) 12126
  • Total vector size (bp) 13794
  • Vector type
    Mammalian Expression, Lentiviral ; tet-on, all-in-one lentiviral vector
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UL148 fused to mCherry
  • Alt name
    human cytomegalovirus UL148
  • Species
    Human herpesvirus 5 (human cytomegalovirus)
  • Insert Size (bp)
    1668
  • GenBank ID
    EF999921.1
  • Promoter Tet responsive element 3G
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TCAGGTAGTGAACCGTCAG
  • 3′ sequencing primer TGATACTGGGGTTCTAAGGC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOUPc-UL148-mCherry was a gift from Jeremy Kamil (Addgene plasmid # 179279 ; http://n2t.net/addgene:179279 ; RRID:Addgene_179279)
  • For your References section:

    The Human Cytomegalovirus Nonstructural Glycoprotein UL148 Reorganizes the Endoplasmic Reticulum. Zhang H, Read C, Nguyen CC, Siddiquey MNA, Shang C, Hall CM, von Einem J, Kamil JP. mBio. 2019 Dec 10;10(6). pii: mBio.02110-19. doi: 10.1128/mBio.02110-19. 10.1128/mBio.02110-19 PubMed 31822584