pOUPc-UL148-mCherry
(Plasmid
#179279)
-
PurposeAll in one "tet-on" lentivirus vector that expresses human cytomegalovirus UL148 fused to an mCherry tag at its cytoplasmic tail. UL148 reorganizes the ER and activates the UPR.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179279 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepOUPc
-
Backbone manufacturerderived from Steven Elledge lab's pInducer20
- Backbone size w/o insert (bp) 12126
- Total vector size (bp) 13794
-
Vector typeMammalian Expression, Lentiviral ; tet-on, all-in-one lentiviral vector
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUL148 fused to mCherry
-
Alt namehuman cytomegalovirus UL148
-
SpeciesHuman herpesvirus 5 (human cytomegalovirus)
-
Insert Size (bp)1668
-
GenBank IDEF999921.1
- Promoter Tet responsive element 3G
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TCAGGTAGTGAACCGTCAG
- 3′ sequencing primer TGATACTGGGGTTCTAAGGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOUPc-UL148-mCherry was a gift from Jeremy Kamil (Addgene plasmid # 179279 ; http://n2t.net/addgene:179279 ; RRID:Addgene_179279) -
For your References section:
The Human Cytomegalovirus Nonstructural Glycoprotein UL148 Reorganizes the Endoplasmic Reticulum. Zhang H, Read C, Nguyen CC, Siddiquey MNA, Shang C, Hall CM, von Einem J, Kamil JP. mBio. 2019 Dec 10;10(6). pii: mBio.02110-19. doi: 10.1128/mBio.02110-19. 10.1128/mBio.02110-19 PubMed 31822584