Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MBP-g0s2
(Plasmid #179294)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 179294 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMAL-c5E
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 5676
  • Total vector size (bp) 5994
  • Modifications to backbone
    none
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    G0S2
  • Alt name
    G0/G1 switch regulatory protein 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    318
  • Mutation
    full-length G0S2, residues 1-103 from accession number NP_056529.1; optimized DNA sequence
  • GenBank ID
    NP_056529.1
  • Promoter Ptac
  • Tag / Fusion Protein
    • mature maltose binding protein + enterokinase cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer MBP-F, GATGAAGCCCTGAAAGACGCGCAG
  • 3′ sequencing primer pMALREV, TGTCCTACTCAGGAGAGCGTTCAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The insert had been ordered from GenScript as an E. coli expression-optimized synthetic DNA.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Protein sequence is the mature maltose binding protein (identical to aa 1-367 of accession no. 6K7E_A) + NSSSNNNNNNNNNNLG + enterokinase cleavage site (DDDDK*; * = cleavage site) + VPH + human G0S2 (G0/G1 switch protein 2; accession number NP_056529.1) + L.
Confers ampicillin-resistance.
This plasmid has been referred to as MBP g0s2, MBP-g0s2, g0s2-noHis_pMAL-c5E, or pHis6-MBP-g0s2. There is no His-tag in the expressed protein sequence.
Backbone vector is pMAL-c5E.
Construct design by James Zook.
Publication: Moran et al 2021 PLoS One 16, e0249164, https://doi.org/10.1371/journal.pone.0249164

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MBP-g0s2 was a gift from Debra Hansen (Addgene plasmid # 179294 ; http://n2t.net/addgene:179294 ; RRID:Addgene_179294)
  • For your References section:

    Biophysical characterization and a roadmap towards the NMR solution structure of G0S2, a key enzyme in non-alcoholic fatty liver disease. Moran MW, Ramirez EP, Zook JD, Saarinen AM, Baravati B, Goode MR, Laloudakis V, Kaschner EK, Olson TL, Craciunescu FM, Hansen DT, Liu J, Fromme P. PLoS One. 2021 Jul 14;16(7):e0249164. doi: 10.1371/journal.pone.0249164. eCollection 2021. 10.1371/journal.pone.0249164 PubMed 34260600