pEGFP-hMC4R
(Plasmid
#179315)
-
PurposeExpress human melanocortin 4 receptor (GFP tagged) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179315 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-N1
- Total vector size (bp) 5710
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemelanocortin 4 receptor
-
Alt nameMC4R
-
SpeciesH. sapiens (human)
-
Insert Size (bp)996
-
GenBank IDNM_005912.3
-
Entrez GeneMC4R (a.k.a. BMIQ20)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer GAGGTCTATATAAGCAGAGC
- 3′ sequencing primer ACTTGTGGCCGTTTACGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-hMC4R was a gift from Christian Gruber (Addgene plasmid # 179315 ; http://n2t.net/addgene:179315 ; RRID:Addgene_179315) -
For your References section:
Development of Melanocortin 4 Receptor Agonists by Exploiting Animal-Derived Macrocyclic, Disulfide-Rich Peptide Scaffolds. Muratspahic E, Aslanoglou D, White AM, Draxler C, Kozisek X, Farooq Z, Craik DJ, McCormick PJ, Durek T, Gruber CW. ACS Pharmacol Transl Sci. 2023 Sep 26;6(10):1373-1381. doi: 10.1021/acsptsci.3c00090. eCollection 2023 Oct 13. 10.1021/acsptsci.3c00090 PubMed 37854631