Skip to main content

pMX-DivisionRecorder
(Plasmid #179446)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179446 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMX
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 6500
  • Vector type
    Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP-P2A-511-CrePI-511
  • Species
    Aequorea victoria, P1 bacteriophage
  • Insert Size (bp)
    2000
  • GenBank ID
    X96418.1 YP_006472.1
  • Promoter LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ACCATCCTCTAGACTGCC
  • 3′ sequencing primer TTTTATTTTATCGTCGACTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMX-DivisionRecorder was a gift from Ton Schumacher (Addgene plasmid # 179446 ; http://n2t.net/addgene:179446 ; RRID:Addgene_179446)
  • For your References section:

    Replicative history marks transcriptional and functional disparity in the CD8(+) T cell memory pool. Bresser K, Kok L, Swain AC, King LA, Jacobs L, Weber TS, Perie L, Duffy KR, de Boer RJ, Scheeren FA, Schumacher TN. Nat Immunol. 2022 May;23(5):791-801. doi: 10.1038/s41590-022-01171-9. Epub 2022 Apr 7. 10.1038/s41590-022-01171-9 PubMed 35393592