pMX-DivisionRecorder
(Plasmid
#179446)
-
PurposeRetroviral expression vector containing the DivisionRecorder cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179446 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMX
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 6500
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP-P2A-511-CrePI-511
-
SpeciesAequorea victoria, P1 bacteriophage
-
Insert Size (bp)2000
-
GenBank IDX96418.1 YP_006472.1
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ACCATCCTCTAGACTGCC
- 3′ sequencing primer TTTTATTTTATCGTCGACTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMX-DivisionRecorder was a gift from Ton Schumacher (Addgene plasmid # 179446 ; http://n2t.net/addgene:179446 ; RRID:Addgene_179446) -
For your References section:
Replicative history marks transcriptional and functional disparity in the CD8(+) T cell memory pool. Bresser K, Kok L, Swain AC, King LA, Jacobs L, Weber TS, Perie L, Duffy KR, de Boer RJ, Scheeren FA, Schumacher TN. Nat Immunol. 2022 May;23(5):791-801. doi: 10.1038/s41590-022-01171-9. Epub 2022 Apr 7. 10.1038/s41590-022-01171-9 PubMed 35393592